Mature sequence ssa-miR-9a-5p

Accession numberMIMAT0032721
IDssa-miR-9a-5p
Stem-Loop ssa-mir-9a-1 ssa-mir-9a-2 ssa-mir-9a-3 ssa-mir-9a-4 ssa-mir-9a-5 ssa-mir-9a-6 ssa-mir-9a-7 ssa-mir-9a-8
Sequence
ucuuugguuaucuagcuguauga
Get sequence
Deep sequencing reads, experiments

References

1