Mature sequence ssa-miR-730a-3p

Accession numberMIMAT0032680
IDssa-miR-730a-3p
Stem-Loop ssa-mir-730a-1
Sequence
cacagcgccugcaauguggagg
Get sequence
Deep sequencing reads, experiments

References

1