Mature sequence ssa-miR-489-3p

Accession numberMIMAT0032658
IDssa-miR-489-3p
Stem-Loop ssa-mir-489-1 ssa-mir-489-2
Sequence
ugacaucauauguacggcugcu
Get sequence
Deep sequencing reads, experiments

References

1