Mature sequence ssa-miR-489-5p

Accession numberMIMAT0032657
IDssa-miR-489-5p
Stem-Loop ssa-mir-489-1 ssa-mir-489-2
Sequence
uggucguauguaugacgucauu
Get sequence
Deep sequencing reads, experiments

References

1