Mature sequence ssa-miR-460-3p

Accession numberMIMAT0032652
IDssa-miR-460-3p
Stem-Loop ssa-mir-460-1 ssa-mir-460-2
Sequence
cacagcgcauacaauguggaug
Get sequence
Deep sequencing reads, experiments

References

1