Mature sequence ssa-miR-456-5p

Accession numberMIMAT0032645
IDssa-miR-456-5p
Stem-Loop ssa-mir-456-1 ssa-mir-456-2
Sequence
gcaggcaucuucccagccuac
Get sequence
Deep sequencing reads, experiments

References

1