Mature sequence ssa-miR-455-5p

Accession numberMIMAT0032643
IDssa-miR-455-5p
Stem-Loop ssa-mir-455
Sequence
uaugugcccuuggacuacaucg
Get sequence
Deep sequencing reads, experiments

References

1