Mature sequence ssa-miR-29b-3p

Accession numberMIMAT0032586
IDssa-miR-29b-3p
Stem-Loop ssa-mir-29b-1 ssa-mir-29b-2 ssa-mir-29b-3 ssa-mir-29b-4
Sequence
uagcaccauuugaaaucgguua
Get sequence
Deep sequencing reads, experiments

References

1