Mature sequence ssa-miR-26b-5p

Accession numberMIMAT0032569
IDssa-miR-26b-5p
Stem-Loop ssa-mir-26b
Sequence
uucaaguaauccaggauagguu
Get sequence
Deep sequencing reads, experiments

References

1