Mature sequence ssa-miR-219b-3p

Accession numberMIMAT0032529
IDssa-miR-219b-3p
Stem-Loop ssa-mir-219b-1 ssa-mir-219b-2
Sequence
agaauuguaucuggacaucugu
Get sequence
Deep sequencing reads, experiments

References

1