Mature sequence ssa-miR-219a-3p

Accession numberMIMAT0032527
IDssa-miR-219a-3p
Stem-Loop ssa-mir-219a-1 ssa-mir-219a-2
Sequence
agaauugugcauggacaucugu
Get sequence
Deep sequencing reads, experiments

References

1