Mature sequence ssa-miR-2188-3p

Accession numberMIMAT0032523
IDssa-miR-2188-3p
Stem-Loop ssa-mir-2188
Sequence
gcugugugaggucagaccuauc
Get sequence
Deep sequencing reads, experiments

References

1