Mature sequence ssa-miR-210-3p

Accession numberMIMAT0032509
IDssa-miR-210-3p
Stem-Loop ssa-mir-210-1 ssa-mir-210-2
Sequence
cugugcgugugacagcggcu
Get sequence
Deep sequencing reads, experiments

References

1