Mature sequence ssa-miR-210-5p

Accession numberMIMAT0032508
IDssa-miR-210-5p
Stem-Loop ssa-mir-210-1 ssa-mir-210-2
Sequence
agccacugacuaacguacauug
Get sequence
Deep sequencing reads, experiments

References

1