Mature sequence ssa-miR-199a-5p

Accession numberMIMAT0032460
IDssa-miR-199a-5p
Stem-Loop ssa-mir-199a-1 ssa-mir-199a-2 ssa-mir-199a-3 ssa-mir-199a-4
Sequence
cccaguguucagacuaccuguuc
Get sequence
Deep sequencing reads, experiments

References

1