Mature sequence ssa-miR-196a-1-3p

Accession numberMIMAT0032454
IDssa-miR-196a-1-3p
Stem-Loop ssa-mir-196a-1
Sequence
ucggcaacaaaaaacugccuuga
Get sequence
Deep sequencing reads, experiments

References

1