Mature sequence ssa-miR-194c-5p

Accession numberMIMAT0032451
IDssa-miR-194c-5p
Stem-Loop ssa-mir-194c
Sequence
uguaacagcaacuccauaugga
Get sequence
Deep sequencing reads, experiments

References

1