Mature sequence ssa-miR-192a-5p

Accession numberMIMAT0032440
IDssa-miR-192a-5p
Stem-Loop ssa-mir-192a-1 ssa-mir-192a-2
Sequence
augaccuaugaauugacagcc
Get sequence
Deep sequencing reads, experiments

References

1