Mature sequence ssa-miR-18a-3p

Accession numberMIMAT0032433
IDssa-miR-18a-3p
Stem-Loop ssa-mir-18a
Sequence
acugcccuaguugcuccuucuggc
Get sequence
Deep sequencing reads, experiments

References

1