Mature sequence ssa-miR-153a-2-5p

Accession numberMIMAT0032389
IDssa-miR-153a-2-5p
Stem-Loop ssa-mir-153a-2
Sequence
ucaucuuugugauuugcagcu
Get sequence
Deep sequencing reads, experiments

References

1