Mature sequence ssa-miR-146d-3p

Accession numberMIMAT0032377
IDssa-miR-146d-3p
Stem-Loop ssa-mir-146d-1
Sequence
cccauggagcucaguucuuaag
Get sequence
Deep sequencing reads, experiments

References

1