Mature sequence ssa-miR-146a-5p

Accession numberMIMAT0032371
IDssa-miR-146a-5p
Stem-Loop ssa-mir-146a-1 ssa-mir-146a-2 ssa-mir-146a-3
Sequence
ugagaacugaauuccauagaugg
Get sequence
Deep sequencing reads, experiments

References

1