Mature sequence ssa-miR-144-3p

Accession numberMIMAT0032368
IDssa-miR-144-3p
Stem-Loop ssa-mir-144
Sequence
cuacaguauagaugauguac
Get sequence
Deep sequencing reads, experiments

References

1