Mature sequence ssa-miR-144-5p

Accession numberMIMAT0032367
IDssa-miR-144-5p
Stem-Loop ssa-mir-144
Sequence
ggauaucaucauauacuguaaguu
Get sequence
Deep sequencing reads, experiments

References

1