Mature sequence ssa-miR-143-3p

Accession numberMIMAT0032366
IDssa-miR-143-3p
Stem-Loop ssa-mir-143
Sequence
ugagaugaagcacuguagcuc
Get sequence
Deep sequencing reads, experiments

References

1