Mature sequence ssa-miR-142a-3p

Accession numberMIMAT0032362
IDssa-miR-142a-3p
Stem-Loop ssa-mir-142a-1 ssa-mir-142a-2
Sequence
aguguuuccuacuuuauggaug
Get sequence
Deep sequencing reads, experiments

References

1