Mature sequence lva-miR-210-3p

Accession numberMIMAT0032214
IDlva-miR-210-3p
Stem-Loop lva-mir-210
Sequence
uugugcgugcgacagcgacuga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).