Mature sequence dre-miR-430i-5p

Accession numberMIMAT0032003
IDdre-miR-430i-5p
Stem-Loop dre-mir-430i-1 dre-mir-430i-2 dre-mir-430i-3
Sequence
acccucacaaaagcacugacu
Get sequence
Deep sequencing15774 reads, 5 experiments

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).