Mature sequence cel-miR-354-5p

Accession numberMIMAT0031894
IDcel-miR-354-5p
Stem-Loop cel-mir-354
Sequence
ggugcggcugcagacggguau
Get sequence
Deep sequencing324 reads, 11 experiments
Database links
QuickGO function

References

1