Mature sequence hsa-miR-203a-5p

Accession numberMIMAT0031890
IDhsa-miR-203a-5p
Sequence
agugguucuuaacaguucaacaguu
Get sequence
Stem-Loop hsa-mir-203a

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17622355 "MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?" Sonkoly E, Wei T, Janson PC, Saaf A, Lundeberg L, Tengvall-Linder M, Norstedt G, Alenius H, Homey B, Scheynius A, Stahle M, Pivarcsi A PLoS One. 2:e610(2007).