Mature sequence hsa-miR-203a-5p

Accession numberMIMAT0031890
IDhsa-miR-203a-5p
Stem-Loop hsa-mir-203a
Sequence
agugguucuuaacaguucaacaguu
Get sequence
Deep sequencing266 reads, 19 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17622355 "MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?" Sonkoly E, Wei T, Janson PC, Saaf A, Lundeberg L, Tengvall-Linder M, Norstedt G, Alenius H, Homey B, Scheynius A, Stahle M, Pivarcsi A PLoS One. 2:e610(2007).