Mature sequence mmu-miR-8096

Accession numberMIMAT0031398
IDmmu-miR-8096
Stem-Loop mmu-mir-8096
Sequence
gggcacgguagcugaagagu
Get sequence
Deep sequencing533 reads, 44 experiments
Predicted targets

References

1