Mature sequence stu-miR5304-3p

Accession numberMIMAT0031236
IDstu-miR5304-3p
Stem-Loop stu-MIR5304
Sequence
agaugaguauggugcauugga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).