Mature sequence hsa-miR-7973

Accession numberMIMAT0031176
IDhsa-miR-7973
Stem-Loop hsa-mir-7973-1 hsa-mir-7973-2
Sequence
ugugacccuagaauaauuac
Get sequence
Deep sequencing11 reads, 8 experiments
Predicted targets

References

1
PMID:23660593 "Research resource: small RNA-seq of human granulosa cells reveals miRNAs in FSHR and aromatase genes" Velthut-Meikas A, Simm J, Tuuri T, Tapanainen JS, Metsis M, Salumets A Mol Endocrinol. 27:1128-1141(2013).