Mature sequence aja-miR-143

Accession numberMIMAT0031147
IDaja-miR-143
Stem-Loop aja-mir-143
Sequence
ugagaugaagcacuguagcucg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23166587 "Transcriptome sequencing and annotation for the Jamaican fruit bat (Artibeus jamaicensis)" Shaw TI, Srivastava A, Chou WC, Liu L, Hawkinson A, Glenn TC, Adams R, Schountz T PLoS One. 7:e48472(2012).