Mature sequence ipu-miR-199a-3p

Accession numberMIMAT0031093
IDipu-miR-199a-3p
Stem-Loop ipu-mir-199a-1 ipu-mir-199a-2 ipu-mir-199a-4
Sequence
acaguagucugcacauugguu
Get sequence
Deep sequencing reads, experiments

References

1