Mature sequence mdo-miR-199b-3-5p

Accession numberMIMAT0031066
IDmdo-miR-199b-3-5p
Stem-Loop mdo-mir-199b-3
Sequence
ccaguguucagacuaccugucc
Get sequence
Deep sequencing57 reads, 5 experiments
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).