Mature sequence hsa-miR-8059

Accession numberMIMAT0030986
IDhsa-miR-8059
Stem-Loop hsa-mir-8059
Sequence
ggggaacuguagaugaaaaggc
Get sequence
Deep sequencing5 reads, 5 experiments
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).