Mature sequence prd-miR-7940a-3p

Accession numberMIMAT0030739
IDprd-miR-7940a-3p
Stem-Loop prd-mir-7940a
Sequence
ucacgcggauugcaucuuucaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).