Mature sequence bta-miR-2285ad

Accession numberMIMAT0030446
IDbta-miR-2285ad
Stem-Loop bta-mir-2285ad
Sequence
aaaacccaaaugaacuuuuugg
Get sequence
Deep sequencing145 reads, 42 experiments
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).