Mature sequence hsa-miR-4433b-5p

Accession numberMIMAT0030413
IDhsa-miR-4433b-5p
Stem-Loop hsa-mir-4433b
Sequence
augucccacccccacuccugu
Get sequence
Deep sequencing76 reads, 38 experiments
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).