Mature sequence hsa-miR-7843-3p

Accession numberMIMAT0030412
IDhsa-miR-7843-3p
Stem-Loop hsa-mir-7843
Sequence
augaagccuucucugccuuacg
Get sequence
Deep sequencing8 reads, 8 experiments
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).