Mature sequence ptc-miR7828

Accession numberMIMAT0030388
IDptc-miR7828
Stem-Loop ptc-MIR7828
Sequence
gaugacauggacaccaaaauc
Get sequence
Deep sequencing reads, experiments

References

1