Mature sequence ptc-miR6462f

Accession numberMIMAT0030376
IDptc-miR6462f
Stem-Loop ptc-MIR6462f
Sequence
ucuuaugcguuuuugucucu
Get sequence
Deep sequencing reads, experiments

References

1