Mature sequence oar-miR-99a

Accession numberMIMAT0030064
IDoar-miR-99a
Stem-Loop oar-mir-99a
Sequence
aacccguagauccgaucuug
Get sequence
Deep sequencing135505 reads, 13 experiments

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).