Mature sequence mtr-miR172d-3p

Accession numberMIMAT0029979
IDmtr-miR172d-3p
Stem-Loop mtr-MIR172d
Sequence
agaaucuugaugaugcugca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).