Mature sequence mmu-miR-290b-3p

Accession numberMIMAT0029901
IDmmu-miR-290b-3p
Stem-Loop mmu-mir-290b
Sequence
aagugcccccauaguuugagua
Get sequence
Deep sequencing3 reads, 3 experiments
Predicted targets

References

1