Mature sequence mmu-miR-465d-3p

Accession numberMIMAT0029881
IDmmu-miR-465d-3p
Stem-Loop mmu-mir-465d
Sequence
ugaucagggccuuucugaguaa
Get sequence
Deep sequencing50179 reads, 50 experiments
Predicted targets

References

1