Mature sequence mmu-miR-465d-5p

Accession numberMIMAT0029880
IDmmu-miR-465d-5p
Stem-Loop mmu-mir-465d
Sequence
uauuuagaaugguacugauguga
Get sequence
Deep sequencing56893 reads, 42 experiments
Predicted targets

References

1