Mature sequence cbn-miR-64j

Accession numberMIMAT0029698
IDcbn-miR-64j
Stem-Loop cbn-mir-64j-1 cbn-mir-64j-2
Sequence
gaugacacuuguauagucacgguug
Get sequence
Deep sequencing reads, experiments

References

1