Mature sequence crm-miR-392

Accession numberMIMAT0029632
IDcrm-miR-392
Stem-Loop crm-mir-392
Sequence
aucaucgaucauguaugcuguc
Get sequence
Deep sequencing reads, experiments

References

1